Bio python sequences - Science with Python

Keyboard shortcuts

Press or to navigate between chapters

Press S or / to search in the book

Press ? to show this help

Press Esc to hide this help

Science with Python

Bio python sequences

from Bio.Seq import Seq

# Nucleotide Sequences
my_dna = Seq("AGTACACTGGTAGGCCTTACAG_T")
print(my_dna)                       # AGTACACTGGTAGGCCTTACAG_T
print(my_dna.complement())          # TCATGTGACCATCCGGAATGTC_A
print(my_dna.reverse_complement())  # A_CTGTAAGGCCTACCAGTGTACT
print(my_dna.transcribe())          # AGUACACUGGUAGGCCUUACAG_U

my_rna = Seq("GAC_U")
print(my_rna)                       # GAC_U
print(my_rna.reverse_complement())  # A_GUC
print(my_rna.reverse_complement())  # A_GUC
print(my_rna.transcribe())          # GAC_U

from Bio.Seq import Seq

what_is_this = Seq("AGTC_U")
what_is_this.complement()  # ValueError: Mixed RNA/DNA found